ÁREA DO FORNECEDOR

ACESSO RESTRITO












Destaques


A Fundação Josué Montello recebe as entregas de segunda a sexta-feira nos horários de 8:00 às 12:00 hs e de 13:00 às 17:00 hs.
Categoria:
Modalidade:
Produto:
 
Categoria:
Modalidade:
Produto:
Período:
 - 
 
5710/2020
25/09/2020 16:00:00
Dispensa de licitação
172/2020 Equipamentos e Produtos Hospitalares/Laboratoriais/Farmaceuticos
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Reagente Primer
Descrição: Reagente Primer TGF-ß1 F rat (CAAACATCACACACAGTA) - Primer TGF-ß1 R rat (GGTGTTGAGCCCTTTCCAGG)
1Kit
Produto/Serviço: Reagente Primer
Descrição: Reagente Primer TRPV4 F rat (TTTGCTTCTTATTTTCTACTCCTCCC) - Primer TRPV4 R rat (GCTGGCTTAGGTGACTCC)
1Kit


6547/2020
22/09/2020 16:00:00
Dispensa de licitação
190/2020 Equipamentos e Produtos de Informática
Nenhum item encontrado.

Produto/ServiçoQuant.Unidade
Produto/Serviço: Fonte
Descrição: Fonte Para Microscopio Bivolt Automatica 90v A 240v - 6v 20w
1Unidade